Sequence ID | >SRA1015157 |
Genome ID | SRR023845.481450 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 114 |
End posion on genome | 39 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcgacggtg |
tRNA gene sequence |
GGGCCTGTAGCTCAACGGTTAGAGCTGGCCGCTCATAACGGCTAGGTTGCGGGTTCGATT |
Downstream region at tRNA end position |
acacccttgc |
Secondary structure (Cloverleaf model) | >SRA1015157 Met CAT g ACCA acacccttgc G - C G - C G - C C - G C - G T + G G - C T T T C G T C C A C A A A | | + | | G G C T C G G C G G G C G | | | | T T T G A G C T A T AGGTT G + T G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |