Sequence ID | >SRA1015159 |
Genome ID | SRR023845.481608 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 75 |
End posion on genome | 149 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctgggggcac |
tRNA gene sequence |
GCCCTCGTAGCCCAACGGTCAGAGGCAGGCGACTTAAAATCGCTTCAGTCAGGGTTCGAA |
Downstream region at tRNA end position |
cgctccgctc |
Secondary structure (Cloverleaf model) | >SRA1015159 Leu TAA c ACtc cgctccgctc G - C C - G C - G C - G T + G C - G G - C T A T G T C C C A C A A A | | | | | G G C C C G C A G G G C G | | | T T T A G G C C A G A TCAGT G + T G - C C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |