Sequence ID | >SRA1015162 |
Genome ID | SRR023845.482537 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 100 |
End posion on genome | 174 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttgaagccga |
tRNA gene sequence |
TGGGGCGTCGCCAAGTGGTAAGGCAGCGGTTTTTGGTACCGCCATTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
attacttaag |
Secondary structure (Cloverleaf model) | >SRA1015162 Gln TTG a GCCA attacttaag T - A G - C G - C G - C G - C C - G G - C T A T G G T C C A G A C | | | | | G T A C C G C C A G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |