Sequence ID | >SRA1015164 |
Genome ID | SRR023845.483056 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 19 |
End posion on genome | 95 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccgtgccgt |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
aattccaaac |
Secondary structure (Cloverleaf model) | >SRA1015164 Met CAT t ACCA aattccaaac C A G - C C - G G - C G - C G - C G - C T A T T G T C C A C G A G | | | | | A C C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |