Sequence ID | >SRA1015166 |
Genome ID | SRR023845.483733 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 49 |
End posion on genome | 138 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgggaccttt |
tRNA gene sequence |
AGAGAGGTGGCAGAGTGGTCGAATGCGACGGATTCGAAATCCGTTATACCTGCAAGGGTA |
Downstream region at tRNA end position |
attgataaga |
Secondary structure (Cloverleaf model) | >SRA1015166 Ser CGA t GCGA attgataaga A - T G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TATACCTGCAAGGGTATC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |