Sequence ID | >SRA1015171 |
Genome ID | SRR023845.486524 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 264 |
End posion on genome | 189 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcaacgagat |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTAGAGCGGATCCCTTACACGGATTAGGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
agcatctcga |
Secondary structure (Cloverleaf model) | >SRA1015171 Val TAC t ACCA agcatctcga G - C G - C G - C C - G G - C C - G T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G AGGTC G + T A - T T - A C - G C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |