Sequence ID | >SRA1015176 |
Genome ID | SRR023845.488219 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 133 |
End posion on genome | 206 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccgccaccgg |
tRNA gene sequence |
GGCCTCGTGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACGGGGGTTCGATTCC |
Downstream region at tRNA end position |
tccttccttt |
Secondary structure (Cloverleaf model) | >SRA1015176 Cys GCA g TCCA tccttccttt G - C G - C C - G C - G T - A C - G G - C T T T C T C C C A G A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T T A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |