Sequence ID | >SRA1015181 |
Genome ID | SRR023845.490221 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 137 |
End posion on genome | 61 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcaatgttgt |
tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACTGGTCTCGGGGTCCAGGGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
ttgccgattt |
Secondary structure (Cloverleaf model) | >SRA1015181 Pro CGG t ACCA ttgccgattt C - G G - C G - C G - C G - C C - G G - C T A T T A T C C A T G A G + | | | | G C C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A G - C G - C T T C G T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |