Sequence ID | >SRA1015186 |
Genome ID | SRR023845.491713 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 148 |
End posion on genome | 222 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cggatcgcag |
tRNA gene sequence |
GGGCGGTTAGCTCAGGGGTAGAGCACAGCATTCACACTGCTGGGGTCCCAGGTTCGAAAC |
Downstream region at tRNA end position |
tataagacat |
Secondary structure (Cloverleaf model) | >SRA1015186 Val CAC g ACCA tataagacat G - C G - C G - C C - G G - C G - C T - A A A T G G T C C A G A A | | | | | G G C T C G C C A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T G - C C - G A - T T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |