Sequence ID | >SRA1015187 |
Genome ID | SRR023845.491907 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 132 |
End posion on genome | 206 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aaagcgaaat |
tRNA gene sequence |
GCGGATGTGGCGCAGCGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
gtgtaatgct |
Secondary structure (Cloverleaf model) | >SRA1015187 Gly GCC t TCGA gtgtaatgct G - C C - G G - C G - C A - T T - A G - C T A T T G C T C A G A G + | | | | G C C G C G G C G A G C G | | | | T T G G C G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |