Sequence ID | >SRA1015188 |
Genome ID | SRR023845.492016 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 210 |
End posion on genome | 134 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggtggaaaat |
tRNA gene sequence |
GGCAGTGTAGCTCAGCTGGTTAGAGCGCCGGATTCATAACCCGGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
ccccctctca |
Secondary structure (Cloverleaf model) | >SRA1015188 Met CAT t ACCA ccccctctca G - C G - C C - G A C G + T T - A G - C T G T C C A C C A C G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |