Sequence ID | >SRA1015189 |
Genome ID | SRR023845.492626 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 105 |
End posion on genome | 20 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaaggccgtc |
tRNA gene sequence |
GCGGGCGTGGCGGAATGGTAGACGCAGCGGACTCAAAATCCGCCGTCCGAAAGGATATGT |
Downstream region at tRNA end position |
cgaccctccc |
Secondary structure (Cloverleaf model) | >SRA1015189 Leu CAA c ACCA cgaccctccc G - C C - G G - C G - C G - C C - G G - C T G T C A G C C A T A A G | | | | | G G G G C G G T C G G C G | | | T T T A C G C A G A CGTCCGAAAGGATAT G - C C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |