Sequence ID | >SRA1015190 |
Genome ID | SRR023845.492803 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 37 |
End posion on genome | 123 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gatttggtcT |
tRNA gene sequence |
GGTATCTTGCCCGAGTGGTCTAAGGGGGCGGACTTAAGATCCGCTAGACGTTTAGTCTGC |
Downstream region at tRNA end position |
cacgactctc |
Secondary structure (Cloverleaf model) | >SRA1015190 Leu TAA T AAag cacgactctc G - C G - C T - A A - T T - A C - G T - A C A T C A C C C A T G A G | | | | | A G G C C C G T G G G C G | | | T T T A G G G C T A G TAGACGTTTAGTCTGC G - C C - G G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |