Sequence ID | >SRA1015192 |
Genome ID | SRR023845.494384 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 210 |
End posion on genome | 136 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tgccgggcgt |
tRNA gene sequence |
GGGCGCGTAGCTCAGTGGTAGAGCACACCCTTCACACGGGTGGGGTCGCAGGTTCAATCC |
Downstream region at tRNA end position |
cgccccttcg |
Secondary structure (Cloverleaf model) | >SRA1015192 Val CAC t ACCA cgccccttcg G - C G - C G - C C - G G - C C - G G - C C T T C G T C C A G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T C - G C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |