Sequence ID | >SRA1015217 |
Genome ID | SRR023845.502732 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 154 |
End posion on genome | 236 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agccccaact |
tRNA gene sequence |
GCGCTTGTGGCGAAATTGGTAGACGCGCTGTCTTCAGGCGGCAGTTCCGCAAGGTGTGGG |
Downstream region at tRNA end position |
ttttgaaaag |
Secondary structure (Cloverleaf model) | >SRA1015217 Leu CAG t ACgt ttttgaaaag G - C C - G G - C C - G T - A T + G G - C T G T C C C T C A T A A G | | | | | G T A G C G G G G A G C G | | | T T G A C G C T A G G TTCCGCAAGGTGT C - G T - A G - C T + G C - G T C T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |