Sequence ID | >SRA1015218 |
Genome ID | SRR023845.503079 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 35 |
End posion on genome | 119 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccgcgatcac |
tRNA gene sequence |
GGAGGGATGCCCGAGCGGTTAAAGGGGACGGACTGTAAATCCGTTGGCTTAGCCTACGTT |
Downstream region at tRNA end position |
tcgcaggtcg |
Secondary structure (Cloverleaf model) | >SRA1015218 Tyr GTA c ACCA tcgcaggtcg G - C G - C A - T G - C G - C G - C A - T T A T C A A C C A C G A G | | | | | A G G C C C G T T G G C G | | | T T T A G G G T A A G TGGCTTAGCCTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |