Sequence ID | >SRA1015220 |
Genome ID | SRR023845.503499 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 106 |
End posion on genome | 181 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgccgggttc |
tRNA gene sequence |
GCCTTGGTAGCTCAGTGGATAGAGCACTTCTCTCCTAAAGAAGGTGTCGGCAGTTCGATT |
Downstream region at tRNA end position |
gccgatctcg |
Secondary structure (Cloverleaf model) | >SRA1015220 Arg CCT c ACGA gccgatctcg G - C C - G C - G T + G T - A G - C G - C T T T C C G T C A T G A A | | | | | G G C T C G G G C A G C G | | | | T T A G A G C T A A GTGTC C - G T - A T - A C - G T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |