Sequence ID | >SRA1015224 |
Genome ID | SRR023845.506191 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 108 |
End posion on genome | 182 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgatgctttt |
tRNA gene sequence |
GGTTGCGTAGTTCAACGGATAGAATAGACGTTTCCTAAACGTTTGATATGGGTTCGATTC |
Downstream region at tRNA end position |
cgtattgtat |
Secondary structure (Cloverleaf model) | >SRA1015224 Arg CCT t ACCA cgtattgtat G - C G - C T - A T + G G - C C - G G - C T T T T G C C C A C A A A | + | | | G G C T T G A T G G G C G | | | + T T A G A A T T A A TGAT G + T A - T C - G G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |