Sequence ID | >SRA1015227 |
Genome ID | SRR023845.507267 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 61 |
End posion on genome | 137 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgttcgacat |
tRNA gene sequence |
GGCAGCGTAGCTCAGTTGGTTAGAGCACCGGACTCATAACCCGGGGGTCGGCAGTTCAAA |
Downstream region at tRNA end position |
tcgaccacct |
Secondary structure (Cloverleaf model) | >SRA1015227 Met CAT t ACCA tcgaccacct G + T G - C C - G A - T G - C C - G G - C T A T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C G - C A C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |