Sequence ID | >SRA1015231 |
Genome ID | SRR023845.510568 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 124 |
End posion on genome | 42 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ccaccgccac |
tRNA gene sequence |
GCGGGCGTGGCGAAATGGTAGACGCATGGGTCTTAAAAACCTTGGTCCGTAAGGATGTGC |
Downstream region at tRNA end position |
gctagcccgg |
Secondary structure (Cloverleaf model) | >SRA1015231 Leu TAA c Aggt gctagcccgg G - C C - G G - C G - C G - C C - G G - C T G T C G C C C A T A A G | | | | | A G A G C G G C G G G C G | | | T T T A C G C A G A GGTCCGTAAGGATGT T T G + T G - C G - C T - A C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |