Sequence ID | >SRA1015256 |
Genome ID | SRR023845.522697 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 28 |
End posion on genome | 114 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgctgatgct |
tRNA gene sequence |
GCCCAGATGGTGAAATTGGTAGACACGCCAGCTTCAGGTGCTGGTGACCTTACGGTCGTG |
Downstream region at tRNA end position |
attctttaca |
Secondary structure (Cloverleaf model) | >SRA1015256 Leu CAG t ACCA attctttaca G - C C - G C - G C - G A - T G - C A - T T G T T C T T C A T A A G + | | | | G T A G T G G G A A G C G | | | T T G A C A C T A G G TGACCTTACGGTCGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |