Sequence ID | >SRA1015268 |
Genome ID | SRR023845.531398 |
Search identical group | |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 172 |
End posion on genome | 96 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
gatacgctcG |
tRNA gene sequence |
GGGGGGTAGGCTCAGCTGGGAGAGCGCCGCGTTCGCAATGCGGAGGTCGTGAGTTCGATC |
Downstream region at tRNA end position |
cgctcattcg |
Secondary structure (Cloverleaf model) | >SRA1015268 Ala CGC G ACCA cgctcattcg G - C G - C G + T G - C G + T G - C T C C T A T A C T C A C G A G + | | | | G T C T C G G T G A G C G | | | | T T G G A G C G A G AGGTC C - G C - G G - C C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |