Sequence ID | >SRA1015276 |
Genome ID | SRR023845.536609 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 191 |
End posion on genome | 117 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ccggtctcac |
tRNA gene sequence |
GCCCCGATAGCTCAGTGGTAGAGCACTTCCATGGTAAGGAAGGGGTCGTCAGTTCAAACC |
Downstream region at tRNA end position |
gctggtcacg |
Secondary structure (Cloverleaf model) | >SRA1015276 Thr GGT c TCCA gctggtcacg G - C C - G C - G C - G C - G G - C A - T C A T C A G T C A G A A | | | | | A T C T C G G T C A G C G | | | | T T G G A G C T A A GGGTC C - G T - A T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |