Sequence ID | >SRA1015283 |
Genome ID | SRR023845.539610 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 42 |
End posion on genome | 115 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctcgcggcgt |
tRNA gene sequence |
GCCCCGTTACGTTAATGGTAAACGGCTTCCTTTGTAACGAAGAGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ccgctttcgc |
Secondary structure (Cloverleaf model) | >SRA1015283 Thr TGT t ACCA ccgctttcgc G - C C - G C - G C - G C - G G - C T - A T T T C G T C C A A A A | | + | | G T T T G C G C G G G C G | | | | T T G A A C G T A G AGAC C - G T - A T - A C - G C C T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |