Sequence ID | >SRA1015288 |
Genome ID | SRR023845.543016 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 21 |
End posion on genome | 94 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aatttatcag |
tRNA gene sequence |
GTCCGTGTAGCGCAGTGGATAGCGCGTCTCCCTCCTAAGGAGAAGGCCGCGGGTTCGAAT |
Downstream region at tRNA end position |
gttttttttt |
Secondary structure (Cloverleaf model) | >SRA1015288 Arg CCT g ACtc gttttttttt G + T T + G C - G C - G G - C T T G - C T A T C G C C C A T G A A | | | | | G G C G C G G C G G G C G | | | | T T A G C G C T A G AGGCC T - A C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |