Sequence ID | >SRA1015321 |
Genome ID | SRR023846.16563 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 115 |
End posion on genome | 204 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gatgcggtgc |
tRNA gene sequence |
GGAAGAGTGTCCGAGTGGTTTAAGGAACTGGTCTTGAAAACCAGCGTAGGGGTAACTCTA |
Downstream region at tRNA end position |
atgcttcgtt |
Secondary structure (Cloverleaf model) | >SRA1015321 Ser TGA c GCCA atgcttcgtt G - C G - C A - T A - T G - C A - T G - C T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A A CGTAGGGGTAACTCTACC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |