Sequence ID | >SRA1015326 |
Genome ID | SRR023846.19235 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 87 |
End posion on genome | 163 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccacgattaA |
tRNA gene sequence |
GCCTCCATAGCTCAGTTGGTAGAGCTTCTGACTTGTAATCAGAGGGTCGTTGGTTCGAGT |
Downstream region at tRNA end position |
ttattcagta |
Secondary structure (Cloverleaf model) | >SRA1015326 Thr TGT A TCCC ttattcagta G - C C - G C - G T + G C - G C - G A - T T G T C A G C C A T G A A | | + | | G T C T C G G T T G G C G | | | | T T G G A G C T A T GGGTC T - A C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |