Sequence ID | >SRA1015334 |
Genome ID | SRR023846.21787 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 16 |
End posion on genome | 90 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgcccacgac |
tRNA gene sequence |
GCGGGCGTAGTTCAGCGGTAGAACGCCAGCTTCCCAAGCTGGATGTCGTCGGTTCGATCC |
Downstream region at tRNA end position |
gcgcctcgct |
Secondary structure (Cloverleaf model) | >SRA1015334 Gly CCC c TCCA gcgcctcgct G - C C - G G - C G - C G - C C - G G - C C T T T A G C C A G A A + | | | | G C C T T G G T C G G C G | | | | T T G G A A C T A G ATGTC C - G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |