Sequence ID | >SRA1015337 |
Genome ID | SRR023846.22775 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 149 |
End posion on genome | 241 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcctcggcat |
tRNA gene sequence |
GGAGGCGTCGCCTAGTGGCCTATGGCGCCCGCCTGCTAAGCGGGTTGAGGGGTGATCCTC |
Downstream region at tRNA end position |
gttccatccc |
Secondary structure (Cloverleaf model) | >SRA1015337 Ser GCT t GCCA gttccatccc G - C G - C A - T G - C G - C C - G G - C T A T C G C C C A T G A C | | | | | A G T C C G G C G G G C G | | | T T C T G G C C T A G TTGAGGGGTGATCCTCCTCTC C - G C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |