Sequence ID | >SRA1015339 |
Genome ID | SRR023846.24075 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 7 |
End posion on genome | 91 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
nnnncgtgtc |
tRNA gene sequence |
TCAGCTGTGGCCGAGCGGTTAAGGCGCTAGATTCAGGTTCTAGTCAACTTTGTTGGCGCG |
Downstream region at tRNA end position |
ttttttacaa |
Secondary structure (Cloverleaf model) | >SRA1015339 Leu CAG c ACAA ttttttacaa T T C - G A - T G A C - G T + G G - C T T T C G C C C A C G A G | | | | | G G G C C G G C G G G C G | | | T T T A G G C T A G TCAACTTTGTTGGC C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |