Sequence ID | >SRA1015350 |
Genome ID | SRR023846.27851 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 209 |
End posion on genome | 117 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgctgcagcc |
tRNA gene sequence |
GGAGACGTGGGTGAGTGGCTGAAACCAGCGGTTTGCTAAACCGCCGTACCGGGTTTACTG |
Downstream region at tRNA end position |
aaatgcatgc |
Secondary structure (Cloverleaf model) | >SRA1015350 Ser GCT c GCCA aaatgcatgc G - C G - C A - T G - C A - T C - G G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACCGGGTTTACTGGTACC G - C C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |