Sequence ID | >SRA1015363 |
Genome ID | SRR023846.30547 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 168 |
End posion on genome | 95 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gagcacacat |
tRNA gene sequence |
GGCGCGATAGCAAAGCGGTTATGCAACGGATTGCAAATCCGTCTAGCCCGGTTCGACTCC |
Downstream region at tRNA end position |
aggattcgac |
Secondary structure (Cloverleaf model) | >SRA1015363 Cys GCA t TCCA aggattcgac G - C G - C C - G G - C C - G G - C A - T T C T G G G C C A G A A | | | | | G C A A C G C C C G G C G | | | T T G A T G C T T A CTAG A - T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |