Sequence ID | >SRA1015537 |
Genome ID | SRR023846.102954 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 125 |
End posion on genome | 53 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tttggggcct |
tRNA gene sequence |
GGCTGCGTAGTTCAAGGGATAGAATAGGCGTTTCCTAAACGCTTGATAGCAGTTCGAATC |
Downstream region at tRNA end position |
atataacttg |
Secondary structure (Cloverleaf model) | >SRA1015537 Arg CCT t ACat atataacttg G + T G - C C - G T + G G + T C - G G - C T A T T C G T C A G A A A | | | | | G G C T T G A G C A G C G | | | + T T A G A A T T A A TGAT G + T G - C C - G G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |