Sequence ID | >SRA1015539 |
Genome ID | SRR023846.103355 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 202 |
End posion on genome | 127 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taccaaacag |
tRNA gene sequence |
TGCGGGGTGGAGCAGTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
aaaaagccgt |
Secondary structure (Cloverleaf model) | >SRA1015539 Met CAT g ACCA aaaaagccgt T T G - C C - G G - C G - C G - C G - C T G T T G A C C A T G A G | | | | | G T C G A G A C T G G C G | | | | T T G G C T C T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |