Sequence ID | >SRA1015542 |
Genome ID | SRR023846.104352 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 228 |
End posion on genome | 154 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cagcggcacc |
tRNA gene sequence |
GGGCCTATAGCTCAATCGGTTAGAGCAGCTGACTCATAATCAGCAGGTCCTTGGTTCGAT |
Downstream region at tRNA end position |
aaaccgcctt |
Secondary structure (Cloverleaf model) | >SRA1015542 Met CAT c ACtt aaaccgcctt G - C G - C G - C C - G C - G T + G A - T T T T G A A C C A T A A A | | | | | G C C T C G C T T G G C G | | | | T T G G A G C T T A A AGGTC G - C C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |