Sequence ID | >SRA1015559 |
Genome ID | SRR023846.111361 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 174 |
End posion on genome | 99 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
agttgctcgg |
tRNA gene sequence |
GGGTGCTTAGCTCAGTTGGTAGAGCGGCGCCTTTACACGGCGTAGGTCGGGGGTTCGAGC |
Downstream region at tRNA end position |
ccccggccaa |
Secondary structure (Cloverleaf model) | >SRA1015559 Val TAC g ACCA ccccggccaa G - C G - C G - C T - A G - C C - G T - A C G T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G AGGTC G + T C - G G - C C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |