Sequence ID | >SRA1015565 |
Genome ID | SRR023846.113527 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 87 |
End posion on genome | 163 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
actcaaaacg |
tRNA gene sequence |
GTGATTGTAGCTCAGTCGGTTAGAGCGCCGGATTGTGGTTCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cgaaaaagcc |
Secondary structure (Cloverleaf model) | >SRA1015565 His GTG g CCTA cgaaaaagcc G - C T - A G - C A - T T T T T G - C C G T T G C C C A T G A A + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |