Sequence ID | >SRA1015566 |
Genome ID | SRR023846.114083 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 62 |
End posion on genome | 143 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgcaacatgg |
tRNA gene sequence |
GGCAGCGTGTCCGAGTGGTTAAGGAGGTAGATTCGAAATCTACTGGGCTCTGCCCGCGCG |
Downstream region at tRNA end position |
tttttttttt |
Secondary structure (Cloverleaf model) | >SRA1015566 Ser CGA g Gtct tttttttttt G - C G + T C - G A - T G - C C - G G - C T A T T G C T C A T G A G + | | | | A G G C C T G C G A G C G | | | T T T A G G A T A G TGGGCTCTGCCCGC G - C T - A A - T G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |