Sequence ID | >SRA1015571 |
Genome ID | SRR023846.115344 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 14 |
End posion on genome | 88 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
agtttgaaaT |
tRNA gene sequence |
GCCTCCATGGCTCAGTGGTTAGAGCACCGGTCTCGTAAACCGGGGGTCGGGAGTTCGACT |
Downstream region at tRNA end position |
cgcgtccaac |
Secondary structure (Cloverleaf model) | >SRA1015571 Thr CGT T ATgg cgcgtccaac G - C C - G C - G T - A C - G C - G A - T T C T C C C T C A T G A G | | | | | G G C T C G G G G A G C G | | | | T T T G A G C T A A GGGTC C - G C - G G - C G - C T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |