Sequence ID | >SRA1015572 |
Genome ID | SRR023846.115632 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 107 |
End posion on genome | 180 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgtatcatga |
tRNA gene sequence |
GCCGTGCTAGCTCAGTTTGGTAGAGCGTTCGACTTTTAATCGATTGGTCGCGGGTTCGAT |
Downstream region at tRNA end position |
cttttttttt |
Secondary structure (Cloverleaf model) | >SRA1015572 Lys TTT a Aaat cttttttttt G + T C - G C - G G + T T - A G - C C - G C T T C G C C C A T G A A | | | | | G T C T C G G C G G G C T | | | | T T G G A G C G T A G TGGTC T T T - A C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |