Sequence ID | >SRA1015575 |
Genome ID | SRR023846.116769 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 125 |
End posion on genome | 200 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
catggacgcg |
tRNA gene sequence |
AAGCGCGTAGCTCAGCTGGTAGAGCAACGGACTTTTAATCTGTAGGTCTTGGGTTCGAAC |
Downstream region at tRNA end position |
caacattcca |
Secondary structure (Cloverleaf model) | >SRA1015575 Lys TTT g ACCA caacattcca A C A - T G - C C - G G - C C - G G - C C A T A A C C C A C G A A | | | | | G T C T C G T T G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G + T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |