Sequence ID | >SRA1015588 |
Genome ID | SRR023846.122641 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 9 |
End posion on genome | 82 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnaatcataa |
tRNA gene sequence |
ACGGGTGTAGTTCAAGGGTAGAATAGCGGTCTCCAAAACCGTTGATGGGAGTTCGAATCT |
Downstream region at tRNA end position |
atcctttact |
Secondary structure (Cloverleaf model) | >SRA1015588 Trp CCA a GCAA atcctttact A - T C - G G - C G - C G - C T - A G - C T A T C T C T C A A A A | + | | | G G C T T G G G G A G C G | | | + T T G G A A T T A A TGAT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |