Sequence ID | >SRA1015591 |
Genome ID | SRR023846.123942 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 92 |
End posion on genome | 166 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
gctatgatgA |
tRNA gene sequence |
GCCTTAGTGGCGCAATGGATAGCGCACCAGACTTCGGATCTGGGGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ttttttaatt |
Secondary structure (Cloverleaf model) | >SRA1015591 Arg TCG A TAta ttttttaatt G - C C - G C - G T + G T - A A - T G - C T G T C C C C C A T A A G | | | | | G G C G C G G G G G G C G | | | | T T A G C G C T A A GGGTT C - G C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |