Sequence ID | >SRA1015592 |
Genome ID | SRR023846.124750 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 159 |
End posion on genome | 232 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gtgttatggc |
tRNA gene sequence |
GCCTCGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGTCCCTGGTTCGATC |
Downstream region at tRNA end position |
ttacacgcgg |
Secondary structure (Cloverleaf model) | >SRA1015592 Phe GAA c ACtt ttacacgcgg G - C C - G C - G T C C - G G - C A - T C T T G G A C C A T G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C G A G AGGTC T - A C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |