Sequence ID | >SRA1015594 |
Genome ID | SRR023846.126662 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 252 |
End posion on genome | 178 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cactggattt |
tRNA gene sequence |
GACCCCATAGCTCAGCTGGATAGAGCAGCTACCTTCTAAGTAGCCGGTCATTGGTTCGAA |
Downstream region at tRNA end position |
ttaccagcct |
Secondary structure (Cloverleaf model) | >SRA1015594 Arg TCT t ACgc ttaccagcct G - C A C C - G C - G C - G C - G A - T T A T T A A C C A C G A A | | | | | G T C T C G A T T G G C G | | | | T T G G A G C A T A A CGGTC G - C C - G T - A A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |