Sequence ID | >SRA1015597 |
Genome ID | SRR023846.127535 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 223 |
End posion on genome | 148 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
nnnnnnngan |
tRNA gene sequence |
GGGTCGTTAGCTCAGCTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCCCGCGTTCGAAT |
Downstream region at tRNA end position |
ttctcttata |
Secondary structure (Cloverleaf model) | >SRA1015597 Lys TTT n ACCA ttctcttata G - C G - C G - C T - A C - G G - C T - A T A T G G C G C A C G A A | | | | | G T C T C G C C G C G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |