Sequence ID | >SRA1015598 |
Genome ID | SRR023846.127961 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 165 |
End posion on genome | 249 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cctcttcagt |
tRNA gene sequence |
GCCGAAGTGGCGAAATCGGTAGACGCAGTTGATTCAAAATCAACCATCGAAAGATGTGCC |
Downstream region at tRNA end position |
ttagtacttc |
Secondary structure (Cloverleaf model) | >SRA1015598 Leu CAA t ACCA ttagtacttc G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | G C A G C G G C C G G C G | | | T T G A C G C T A G A CATCGAAAGATGT G - C T - A T - A G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |