Sequence ID | >SRA1015599 |
Genome ID | SRR023846.128340 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 172 |
End posion on genome | 246 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggatcgagat |
tRNA gene sequence |
GCACACGTAGCTCAGCGGTAGAGTGCTCGGTTGTCAGCCGAACGGTCGCGGGTTCGATCC |
Downstream region at tRNA end position |
aagccccatc |
Secondary structure (Cloverleaf model) | >SRA1015599 Asp GTC t GCCA aagccccatc G - C C - G A - T C - G A - T C - G G - C C T T T G C C C A G A A + | | | | G C C T C G G C G G G C G | | | + T T G G A G T T A G CGGTC C A T - A C - G G - C G - C T G T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |