Sequence ID | >SRA1015605 |
Genome ID | SRR023846.130403 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 74 |
End posion on genome | 148 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccgtcttcgt |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCGTAGGTTCGAAC |
Downstream region at tRNA end position |
attcttccag |
Secondary structure (Cloverleaf model) | >SRA1015605 Lys CTT t CCAa attcttccag G A G - C G - C T - A G - C A - T T - A C A T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |