Sequence ID | >SRA1015609 |
Genome ID | SRR023846.131316 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 96 |
End posion on genome | 6 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agccccattc |
tRNA gene sequence |
AGAGAGGTGTCCGAGTGGTCGAAGGAGCACGCCTGGAAAGTGTGTATGGCTCAAAAGGTC |
Downstream region at tRNA end position |
attatnnnnn |
Secondary structure (Cloverleaf model) | >SRA1015609 Ser GGA c GCTA attatnnnnn A - T G - C A - T G - C A - T G - C G - C T A T T A C C C A T G A G + | | | | G G G C C T G T G G G C G | | | T T T A G G A C G A G TATGGCTCAAAAGGTCATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |